ID: 1009953095_1009953105

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1009953095 1009953105
Species Human (GRCh38) Human (GRCh38)
Location 6:70419131-70419153 6:70419172-70419194
Sequence CCTGTTTTGGCCAGGCATGGTGG GCACTTTGGGAGGCCGAGGCAGG
Strand - +
Off-target summary {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141} {0: 84291, 1: 218536, 2: 234154, 3: 158283, 4: 172560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!