ID: 1010104069_1010104075

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1010104069 1010104075
Species Human (GRCh38) Human (GRCh38)
Location 6:72147530-72147552 6:72147552-72147574
Sequence CCTCTGTTTCCCAAGGAGTCCCA AGGCTATCAAAAGCTATTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 38, 4: 257} {0: 1, 1: 0, 2: 0, 3: 17, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!