ID: 1010107072_1010107084

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1010107072 1010107084
Species Human (GRCh38) Human (GRCh38)
Location 6:72182617-72182639 6:72182668-72182690
Sequence CCGCGCCAGGCACGAGCGGCGCC GGCGGGCGCGGCGCTGCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106} {0: 1, 1: 0, 2: 7, 3: 84, 4: 757}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!