ID: 1010190248_1010190252

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1010190248 1010190252
Species Human (GRCh38) Human (GRCh38)
Location 6:73187953-73187975 6:73187968-73187990
Sequence CCCCATTAGGGCAAAAAAGGCAG AAAGGCAGTTGGAAGTATGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 184} {0: 1, 1: 0, 2: 1, 3: 20, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!