ID: 1010244405_1010244414

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1010244405 1010244414
Species Human (GRCh38) Human (GRCh38)
Location 6:73650010-73650032 6:73650058-73650080
Sequence CCGAGATGGATGTGATGACAAAG TGGCAAGAAAATAAAGTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166} {0: 1, 1: 0, 2: 3, 3: 31, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!