ID: 1010318422_1010318423

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1010318422 1010318423
Species Human (GRCh38) Human (GRCh38)
Location 6:74477745-74477767 6:74477762-74477784
Sequence CCTGGTAGAGGTGGTCAGCAGCA GCAGCAGACAGACCACACAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 28, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!