ID: 1010446227_1010446230

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1010446227 1010446230
Species Human (GRCh38) Human (GRCh38)
Location 6:75951538-75951560 6:75951578-75951600
Sequence CCAGAAATTTTATTCACTTTCCA TTTATGCAATTGGATTTTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 49, 4: 503}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!