ID: 1010456882_1010456885

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1010456882 1010456885
Species Human (GRCh38) Human (GRCh38)
Location 6:76066302-76066324 6:76066338-76066360
Sequence CCAATGATGTGCTGCTTATAAAA ACTCATAGACTGAAGCTAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 33, 4: 336} {0: 1, 1: 0, 2: 14, 3: 261, 4: 1256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!