ID: 1010825041_1010825042

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1010825041 1010825042
Species Human (GRCh38) Human (GRCh38)
Location 6:80462889-80462911 6:80462914-80462936
Sequence CCAGATTGTGATGCACTGGGAGC GCCACCATGAACATATCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74} {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!