ID: 1011039343_1011039347

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1011039343 1011039347
Species Human (GRCh38) Human (GRCh38)
Location 6:83013264-83013286 6:83013302-83013324
Sequence CCAGTAACAGGCTAAGACCTGTT AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 201, 4: 337} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!