|
Left Crispr |
Right Crispr |
Crispr ID |
1011069097 |
1011069102 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:83361636-83361658
|
6:83361675-83361697
|
Sequence |
CCCTGCCATCTTCTGCAGATAAA |
GACAGCTCCTGGCCTGTTACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 193, 2: 176, 3: 137, 4: 303} |
{0: 2, 1: 169, 2: 189, 3: 148, 4: 273} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|