ID: 1011132504_1011132508

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1011132504 1011132508
Species Human (GRCh38) Human (GRCh38)
Location 6:84065864-84065886 6:84065884-84065906
Sequence CCTCCTCAAGCCAAAAGGGATTC TTCTACCAGGACACTGCCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 43, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!