ID: 1011399475_1011399480

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1011399475 1011399480
Species Human (GRCh38) Human (GRCh38)
Location 6:86944221-86944243 6:86944261-86944283
Sequence CCCATGGCTTCTGCTGTGTTCCT TAGTTTCAGCCTAATTCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 324} {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!