ID: 1011666354_1011666361

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1011666354 1011666361
Species Human (GRCh38) Human (GRCh38)
Location 6:89638547-89638569 6:89638580-89638602
Sequence CCAATCTCAGAGGGCGCGCACGC CCCCGGAACCCGCCCCGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 27} {0: 1, 1: 0, 2: 1, 3: 1, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!