ID: 1011670495_1011670501

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1011670495 1011670501
Species Human (GRCh38) Human (GRCh38)
Location 6:89678745-89678767 6:89678772-89678794
Sequence CCTGTAAGGGAAAACAAGGCGGG GGAGACAATAAGAAAATCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98} {0: 1, 1: 0, 2: 2, 3: 34, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!