ID: 1011687416_1011687423

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1011687416 1011687423
Species Human (GRCh38) Human (GRCh38)
Location 6:89834721-89834743 6:89834762-89834784
Sequence CCTGGCCTCAAAATTTGTTTTTT AGCACTGAAGGGCTTTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 72, 3: 511, 4: 3007} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!