ID: 1011690432_1011690435

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1011690432 1011690435
Species Human (GRCh38) Human (GRCh38)
Location 6:89861986-89862008 6:89862017-89862039
Sequence CCTCTCAAAGTGCTGGGATTATA CTACCATGCCTGGCCAAAGCTGG
Strand - +
Off-target summary {0: 1280, 1: 39682, 2: 334961, 3: 254257, 4: 135745} {0: 1, 1: 2, 2: 26, 3: 144, 4: 762}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!