ID: 1012168769_1012168772

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1012168769 1012168772
Species Human (GRCh38) Human (GRCh38)
Location 6:95991602-95991624 6:95991651-95991673
Sequence CCACATTCATGGGCTCAGGAAGG CTGCAGCTGAAGACAGATCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 222} {0: 1, 1: 0, 2: 2, 3: 27, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!