ID: 1012181314_1012181321

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1012181314 1012181321
Species Human (GRCh38) Human (GRCh38)
Location 6:96156465-96156487 6:96156512-96156534
Sequence CCTGAAAGCAGGTTGCCAGTTTT ATATATAAGCTGATGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 51, 4: 237} {0: 1, 1: 2, 2: 8, 3: 25, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!