ID: 1012183596_1012183598

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1012183596 1012183598
Species Human (GRCh38) Human (GRCh38)
Location 6:96186435-96186457 6:96186460-96186482
Sequence CCTGCAGCCTTCTTCTTAGTATG AACGTCCCTGATATGCACGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145} {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!