ID: 1012245884_1012245898

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1012245884 1012245898
Species Human (GRCh38) Human (GRCh38)
Location 6:96925032-96925054 6:96925084-96925106
Sequence CCAGTCTCTCTCCTTGTAACCTG GCTGCTGGTGCGCCAAGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 280} {0: 1, 1: 0, 2: 2, 3: 7, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!