ID: 1012578417_1012578420

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1012578417 1012578420
Species Human (GRCh38) Human (GRCh38)
Location 6:100831608-100831630 6:100831630-100831652
Sequence CCATCAAAATGATTCCTGGGGCC CACAGCTACTATAGAAATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!