ID: 1012647942_1012647945

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1012647942 1012647945
Species Human (GRCh38) Human (GRCh38)
Location 6:101712238-101712260 6:101712275-101712297
Sequence CCTGTGTGTGGTCCACTGAGCAG ATGCAGAAATACAGAATCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 5, 3: 49, 4: 501}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!