ID: 1012665634_1012665637

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1012665634 1012665637
Species Human (GRCh38) Human (GRCh38)
Location 6:101964845-101964867 6:101964890-101964912
Sequence CCAGGTCATGCAAGGCAGAAATG GAGAACATGTGGCAATTAGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 39, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!