ID: 1012799811_1012799821

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1012799811 1012799821
Species Human (GRCh38) Human (GRCh38)
Location 6:103811361-103811383 6:103811414-103811436
Sequence CCAGCTGGAAACCTTATTTTCCA GCCAATTTCTCAAAAATGAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!