ID: 1012908886_1012908891

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1012908886 1012908891
Species Human (GRCh38) Human (GRCh38)
Location 6:105097410-105097432 6:105097445-105097467
Sequence CCTTGGGGCTGCAACGTGGCATC GACGCCACGCCCGCTGGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 92} {0: 1, 1: 0, 2: 0, 3: 16, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!