ID: 1013057661_1013057663

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1013057661 1013057663
Species Human (GRCh38) Human (GRCh38)
Location 6:106600101-106600123 6:106600124-106600146
Sequence CCTAGTTCAGTCAGCAGACAGAC AGGAAGCCTCCAGCACCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!