ID: 1013099085_1013099096

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1013099085 1013099096
Species Human (GRCh38) Human (GRCh38)
Location 6:106973393-106973415 6:106973419-106973441
Sequence CCCTCCCCCATCAAAGAATTGAG GGCTCGGGAGCGCAGCGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185} {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!