ID: 1013229035_1013229040

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1013229035 1013229040
Species Human (GRCh38) Human (GRCh38)
Location 6:108144711-108144733 6:108144734-108144756
Sequence CCGCACCTGGCCTGGAATTTTTA TTTTAAACACAAATGGAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 37, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!