ID: 1013251845_1013251857

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1013251845 1013251857
Species Human (GRCh38) Human (GRCh38)
Location 6:108342187-108342209 6:108342233-108342255
Sequence CCCTCTGTCCTGTTTCCTGCAAG AGCCAGGAGCCAGCCAGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 334} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!