ID: 1013267977_1013267981

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1013267977 1013267981
Species Human (GRCh38) Human (GRCh38)
Location 6:108518909-108518931 6:108518946-108518968
Sequence CCTCTTTACAGTGTCCCTGGGGA CAGACCAGCTCCAAACAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!