ID: 1013437570_1013437576

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1013437570 1013437576
Species Human (GRCh38) Human (GRCh38)
Location 6:110126831-110126853 6:110126858-110126880
Sequence CCTGTCTCCTTCTCCCTAATCTG TTTCACTGGCCTTTATTCTCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 42, 4: 425} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!