ID: 1013468216_1013468225

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1013468216 1013468225
Species Human (GRCh38) Human (GRCh38)
Location 6:110436252-110436274 6:110436300-110436322
Sequence CCCTGATAGTGCTGGTGGCACCA TGATCCAGCAGAATGAATCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!