ID: 1013490814_1013490828

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1013490814 1013490828
Species Human (GRCh38) Human (GRCh38)
Location 6:110644750-110644772 6:110644784-110644806
Sequence CCCTCCTTCCTCTGGTGTTTTAG AGGTGAAGGGGGCCAGGGGGAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 32, 4: 340} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!