ID: 1013607589_1013607596

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1013607589 1013607596
Species Human (GRCh38) Human (GRCh38)
Location 6:111764866-111764888 6:111764901-111764923
Sequence CCTTCCCTTCCCTGCTGTGGCTC TCCCCTTTGCTGGCAGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 92, 4: 771} {0: 1, 1: 1, 2: 2, 3: 40, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!