ID: 1013607593_1013607604

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1013607593 1013607604
Species Human (GRCh38) Human (GRCh38)
Location 6:111764876-111764898 6:111764929-111764951
Sequence CCTGCTGTGGCTCATTCTCTCTT GGGTGCTCTGATGGAACCGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!