ID: 1013851673_1013851675

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1013851673 1013851675
Species Human (GRCh38) Human (GRCh38)
Location 6:114523462-114523484 6:114523495-114523517
Sequence CCTTTATTTATTACTATGGTGGA ATGGAAGCATAGAATTATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 178} {0: 1, 1: 0, 2: 0, 3: 14, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!