ID: 1013992035_1013992044

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1013992035 1013992044
Species Human (GRCh38) Human (GRCh38)
Location 6:116265136-116265158 6:116265164-116265186
Sequence CCACAGTGGCAGAGGAAATGCAG GGGGTGGGGAGTGGAAGGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 46, 3: 534, 4: 4215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!