ID: 1014022451_1014022455

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1014022451 1014022455
Species Human (GRCh38) Human (GRCh38)
Location 6:116606479-116606501 6:116606521-116606543
Sequence CCTATCTTACGGTGAGTAAGAGC ATTAAGTGCTACCAACTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!