ID: 1014084858_1014084864

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1014084858 1014084864
Species Human (GRCh38) Human (GRCh38)
Location 6:117330603-117330625 6:117330644-117330666
Sequence CCCAGAAGAAGGAGCAGACACCC CCTCCTTGAGTTACATATCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 96, 3: 139, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!