ID: 1014084860_1014084864

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1014084860 1014084864
Species Human (GRCh38) Human (GRCh38)
Location 6:117330623-117330645 6:117330644-117330666
Sequence CCCATTTTTGCTGCTCTCCAGCC CCTCCTTGAGTTACATATCCAGG
Strand - +
Off-target summary {0: 4, 1: 32, 2: 126, 3: 177, 4: 672} {0: 1, 1: 3, 2: 96, 3: 139, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!