ID: 1014088969_1014088974

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1014088969 1014088974
Species Human (GRCh38) Human (GRCh38)
Location 6:117381394-117381416 6:117381434-117381456
Sequence CCTCCCTCCTTCTGAGTCTCCAA TGTATGCTTTTGCATACCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 12, 3: 26, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!