ID: 1014098175_1014098182

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1014098175 1014098182
Species Human (GRCh38) Human (GRCh38)
Location 6:117482573-117482595 6:117482597-117482619
Sequence CCGACGTGCGGGGCGGGGCGGGG CGGGCGGGAGACGCCCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 75, 4: 382} {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!