ID: 1014116740_1014116758

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1014116740 1014116758
Species Human (GRCh38) Human (GRCh38)
Location 6:117675451-117675473 6:117675495-117675517
Sequence CCAATCGGAACTGTCCATGTACT GGAGGAGGAAGATGGCGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47} {0: 2, 1: 1, 2: 8, 3: 95, 4: 944}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!