ID: 1014149911_1014149920

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1014149911 1014149920
Species Human (GRCh38) Human (GRCh38)
Location 6:118042816-118042838 6:118042849-118042871
Sequence CCAATTGAATGTGGAACATATGG GCTTTTGGAAGGGCTGGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 145} {0: 1, 1: 0, 2: 1, 3: 20, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!