ID: 1014246732_1014246752

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1014246732 1014246752
Species Human (GRCh38) Human (GRCh38)
Location 6:119078296-119078318 6:119078349-119078371
Sequence CCATCTTCCCAACAGACCCCAGC GCCCGTGGAGCAACGACGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 600} {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!