ID: 1014246736_1014246752

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1014246736 1014246752
Species Human (GRCh38) Human (GRCh38)
Location 6:119078303-119078325 6:119078349-119078371
Sequence CCCAACAGACCCCAGCCGGGGCA GCCCGTGGAGCAACGACGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148} {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!