ID: 1014246737_1014246751

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1014246737 1014246751
Species Human (GRCh38) Human (GRCh38)
Location 6:119078304-119078326 6:119078334-119078356
Sequence CCAACAGACCCCAGCCGGGGCAC CGCGGGTGGAGGCAGGCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 266} {0: 1, 1: 0, 2: 0, 3: 21, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!