ID: 1014416983_1014416986

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1014416983 1014416986
Species Human (GRCh38) Human (GRCh38)
Location 6:121195361-121195383 6:121195388-121195410
Sequence CCTACCATCTTCTGCAGATAACC TACTTCTGAGAGACAGCTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 208, 3: 230, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!