ID: 1014534198_1014534200 |
View in Genome Browser |
Spacer: 12 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1014534198 | 1014534200 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 6:122596623-122596645 | 6:122596658-122596680 |
Sequence | CCAAGAGCTCTCTCTCAAAAGGA | AGTTATCTGCAGAAGATGGCAGG |
Strand | - | + |
Off-target summary | No data | {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |