ID: 1014534198_1014534200

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1014534198 1014534200
Species Human (GRCh38) Human (GRCh38)
Location 6:122596623-122596645 6:122596658-122596680
Sequence CCAAGAGCTCTCTCTCAAAAGGA AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary No data {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!